Table 1 sgRNAs used, and their corresponding position within the target open reading frame. Column 1: sgRNA name. Column 2: sgRNA nucleotide position in the orf. Column 3: sgRNA sequence
| Designation | Position within open reading frame | Sequence |
|---|---|---|
| gfp sgRNA 1 | 329–348 | GCGCCGAGGTGAAGTTCGAG |
| gfp sgRNA 2 | 563–582 | CCATCGGCGACGGCCCCGTG |
| orf45 sgRNA 1 | 184–202 | CCCAGACGACGTCTTCGCCG |
| orf45 sgRNA 2 | 253–272 | GATCAGTCGAGCGGCGAATC |
| orf73 sgRNA 1 | 113–132 | ACCTACATCTACAACCGCGA |
| orf73 sgRNA 2 | 143–162 | TCGCCGACTCCGTCGACGGC |